·Basic Research· ·Current Issue· ·Achieve· ·Search Articles· ·Online Submission· ·About IJO· PMC

Expression of microRNAs in fibroblast of pterygium

Joon H. Lee¹, Sun-Ah Jung¹, Young-A Kwon², Jae-Lim Chung², Ungsoo Samuel Kim^2,3

¹Myung-Gok Eye Research Institute, Konyang University College of Medicine, Seoul 07301, Korea

²Department of Ophthalmology, Kim’s Eye Hospital, Seoul 07301, Korea

³Department of Ophthalmology, Konyang University College of Medicine, Daejeon 35356, Korea

Correspondence to: Ungsoo Samuel Kim. Department of Ophthalmology, Kim’s Eye Hospital, Youngdeungpo 4th 156, Youngdeungpo-gu, Seoul 07301, Korea. ungsookim@kimeye.com

Received: 2015-09-02 Accepted: 2016-01-19

Abstract

AIM: To screen microRNAs (miRNAs) and set up target miRNAs in pterygium.

METHODS: Primary fibroblasts were isolated from pterygium and Tenon's capsule and cultured. Immunocytochemical analysis and Western blotting were performed to confirm the culture of fibroblasts. In all, 1733 miRNAs were screened in the first step by using GeneChip^® miRNA3.0 Array. Specific miRNAs involved in the pathogenesis of pterygium were subsequently determined using the following criteria: 1) high reproducibility in a repetitive test; 2) base log value of >7.0 for both control and pterygial fibroblasts; and 3) log ratio of >1.0 between pterygial fibroblasts and control fibroblasts.

RESULTS: Primary screening showed that 887/1733 miRNAs were up-regulated and 846/1733 miRNAs were down-regulated in pterygial fibroblasts compared with those in control fibroblasts. Of the 1733 miRNAs screened, 4 miRNAs, namely, miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p, met the above-mentioned criteria. Primary screening showed that these 4 miRNAs were up-regulated in pterygial fibroblasts compared with control fibroblasts and that miRNA-143a-3p had the highest mean ratio compared with the miRNAs in control fibroblasts.

CONCLUSION: miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p are up-regulated in pterygial fibroblasts compared with control fibroblasts, suggesting their involvement in the pathogenesis of pterygium.

KEYWORDS: microRNA; pterygium; fibroblast

DOI:10.18240/ijo.2016.07.05

Citation: Lee JH, Jung SA, Kwon YA, Chung JL, Kim US. Expression of microRNAs in fibroblast of pterygium. Int J Ophthalmol 2016;9(7):967-972

INTRODUCTION

Conjunctival or subconjunctival hyperplasia is a complication of ocular surgery (including strabismus, pterygium, glaucoma, and retinal surgery) and represents the primary pathogenesis of disorders such as pterygium and pinguecula^[1-2]. Pterygium is a wing-shaped fibrovascular lesion of the ocular surface that is characterized by extensive chronic inflammation, cell proliferation, connective tissue remodeling, and angiogenesis^[3]. Fibroblast activation by transforming growth factor-β plays a key role in the pathogenesis of pterygium^[4].

MicroRNAs (miRNAs) are small, non-coding RNAs that regulate gene expression usually by repressing the translation of mRNAs through complementary base pairing^[5]. miRNA expression is associated with the pathogenesis of various eye disorders, including cataract and pterygium^[6-7]. Recent studies suggest that miRNA-145 levels decrease with an increase in the severity of pterygium and that miRNA-145 expression is negatively correlated with pterygium extension and vascularity^[8]. Engelsvold et al^[9] observed a concerted down-regulation of 4 miRNAs belonging to miRNA-200 family (miRNA-200a, miRNA-200b, miRNA-429 and miRNA-200c/miRNA-141) in pterygial tissues compared with those in the normal conjunctiva. These miRNAs regulate epithelial-mesenchymal transition, suggesting that they are involved in the pathogenesis of pterygium. Differential expression of miRNA-145 and miRNAs belonging to the miRNA-200 family in pterygium suggests that additional miRNAs are involved in its pathogenesis. Therefore, we examined the expression of miRNAs in pterygial fibroblasts to determine other miRNAs involved in the pathogenesis of pterygium.

MATERIALS AND METHODS

This study was approved by the Institutional Review Board (IRB) of Kim's Eye Hospital. All participants included in this study provided written informed consent, and the consent form was approved by the IRB. All procedures used in this study conformed to the guidelines mentioned in the Declaration of Helsinki.

Primary Fibroblast Culture Pterygium samples were obtained from 5 patients with primary pterygium by performing elective surgery. In addition, normal nasal side Tenon's capsule tissues were obtained from 5 controls by performing elective strabismus procedures. All the patients were asked to not use eye drops containing steroids, nonsteroidal anti-inflammatory drugs, and antibiotics.

The conjunctival tissue of pterygium was removed to isolate pure subconjunctival fibroblasts. The isolated fibroblasts (passage 2; density, 2×10⁶ cells/p100 dish) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 50 g/mL penicillin, and 50 g/mL streptomycin at 37℃ in a humidified atmosphere containing 5% CO₂ (Figure 1).

Figure 1 Histological analysis Fibroblasts cultured from pterygial tissue (A) and Tenon's capsule tissue (B). Scale bar: 100 μm.

Immunocytochemical analysis and Western blotting were performed to confirm the culture of fibroblasts. Fibroblasts attached to the chamber slides were washed and fixed with 4% (v/v) formaldehyde for 5min at room temperature. The cells were then permeabilized using 0.05% (v/v) Triton X-100 in phosphate-buffered saline (PBS) for 5min. Next, the cells were incubated overnight at 4℃ with an appropriate primary antibody against vimentin (dilution, 1:100 in PBS; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The cells were then incubated in the dark with fluorescein isothiocyanate (FITC)-conjugated anti-mouse IgG secondary antibody (dilution, 1:100 in PBS; Vector Laboratories, Peterborough, UK) for 2h at room temperature. Finally, the cells were washed 3 times with PBS and were examined under an immunofluorescence microscope (IX71 instrument; Olympus, Japan). Fibroblasts incubated with normal-buffered serum without the anti-vimentin primary antibody were used as negative controls.

Fibroblasts were washed twice with ice-cold PBS and lysed in cold 1× cell lysis buffer containing 20 mmol/L Tris-HCl (pH 7.5), 150 mmol/L NaCl, 1% Triton X-100, 1 mmol/L Na₂EDTA, 1 mmol/L EGTA, 1 mmol/L PMSF, 1 µg/mL leupeptin, 1 mmol/L Na₃VO₄, 2.5 mmol/L sodium pyrophosphate, and 1 mmol/L glycerophosphate (Cell Signaling Technology, MA, USA) by sonication on ice for 10min. Protein concentrations in the cell lysates were determined using Bradford reagent (Sigma-Aldrich, Germany). Proteins in the cell lysates were resolved using an appropriate percentage of sodium dodecyl sulfate-polyacrylamide gel and were transferred onto a nitrocellulose membrane. The membrane was incubated overnight with the primary antibody against vimentin at 4℃. After washing, the membrane was incubated with HRP-conjugated sheep anti-mouse IgG secondary antibody (Amersham Pharmacia Biotech Ltd., UK) for 1h at room temperature. Protein signals were detected using an enhanced chemiluminescence (ECL) western blot detection reagent (Amersham Pharmacia Biotech Ltd., UK).

Screening of miRNAs in Fibroblasts

Sample preparation Total RNA was extracted from fibroblasts by using TRI Reagent^® (MRC, OH, USA), according to the manufacturer's protocol. After homogenization, 1 mL of the solution was transferred to a 1.5 mL Eppendorf tube and was centrifuged at 12 000 g× for 10min at 4℃ to remove insoluble material. Supernatant containing the RNA was collected, mixed with 0.2 mL chloroform, and centrifuged at 12 000 g× for 15min at 4℃. Next, RNA in the aqueous phase was transferred to a new tube, was precipitated using 0.5 mL isopropyl alcohol, and was recovered by centrifugation at 12 000 g× for 10min at 4℃. RNA pellet obtained was washed briefly with 1 mL 75% ethanol and was centrifuged at 7500 g× for 5min at 4℃. The RNA pellet was dissolved in nuclease-free water, and quality and quantity of RNA were assessed using Agilent 2100 Bioanalyzer. miRNA expression was assessed using GeneChip^® miRNA 3.0 Array (miRBase Version 17; Affymetrix, Santa Clara, CA, USA), which contains approximately 1733 mature human miRNAs.

Microarray Biotin-3′-labeled DNA was prepared from 1000 ng total RNA by using a standard protocol (Expression Analysis Technical Manual, 2001; Affymetrix). This biotin-3′-labeled DNA was hybridized on GeneChip^® miRNA3.0 Arrays for 16-18h at 48℃. The gene chips were washed and stained in GeneChip^® Fluidics Station 450 (Affymetrix, Santa Clara, CA, USA) and were scanned using GeneChip^® Scanner 3000 7G (Affymetrix, Santa Clara, CA, USA). Data obtained were analyzed by performing RMA and DABG analysis using Affymetrix default settings and were normalized by global scaling. Normalized log transformed intensity values were analyzed using Expression Console software v1.3 (Affymetrix, Santa Clara, CA, USA). Fold-change filters included the requirement that miRNAs be at least 200% of controls for up-regulated miRNAs and lower than 50% of controls for down-regulated miRNAs. Variation in miRNA expression was analyzed for predicting target miRNAs. Target miRNAs were predicted using TargetScan version 6.2 (http://www.targetscan.org/), with a context score percentile of >90 for determining differentially expressed miRNAs. Hierarchical clustering required clustered groups that behave similarly across experiments using GeneSpring GX 12.6 (Agilent Technologies, CA, USA). Clustering algorithm used Euclidean distance with average linkage.

Secondary miRNA Analysis miRNAs identified during primary screening were analyzed further to determine target miRNAs. Target miRNAs were selected based on the following criteria: 1) high reproducibility in a repetitive test; 2) base log value of >7.0 for both control and pterygial fibroblasts; 3) log ratio of >1.0 between pterygial fibroblasts and control fibroblasts. High reproducibility was defined as the constant expression either upregulation or downregulation.

Total RNA was extracted from cultured fibroblasts, and cDNA was synthesized using first-strand cDNA synthesis kit (GE Healthcare). Primers 143-3p (UGAGAUGAAGCACUGUAGCUC), 181a-2-3p (ACCACUGACCGUUGACUGUACC), 377-5p (AGAGGUUGCCCUUGGUGAAUUC), and 411a-5p (UAGUAGACCGUAUAGCGUACG) and SYBR Green-based real-time PCR system (MyIQ, Bio-Rad) were used to compare the expression of mature miRNAs in pterygial and control fibroblasts. Data were analyzed using SPSS ver. 15.0 (SPSS Inc., Chicago, IL, USA). Mann-Whitney U test was used to differentiate miRNA levels in the 2 groups. Differences were considered significant at P-values of <0.05.

RESULTS

The mean ages of patients with pterygium (2 men and 3 women) and controls (2 men and 3 women) were 62.5y (range, 49-75y) and 63.5y (range, 52-74y), respectively (P =0.675).

Primary Fibroblast Culture Under the immunohistochemistry, single images of the sections of FITC-fluorescence (vimentin) were observed by confocal laser scanning fluorescent microscopy in both fibroblasts. Western blotting by using anti-vimentin antibody detected vimentin expression in both pterygial and control fibroblasts. Analysis of the nuclear morphology of fibroblasts with DAPI showed well-defined structures (Figure 2).

Figure 2 Confocal immunofluorescence microscopy and Western blotting Immunofluorescence analysis and western blotting detected vimentin in both pterygial and control fibroblasts.

Primary miRNA Screening and Analysis Of the 1733 miRNAs screened, 887 were up-regulated and 846 were down-regulated in pterygial fibroblasts compared with those in control fibroblasts (Figure 3). In all, 90 (5.2%) miRNAs were down-regulated (log ratio of less than -1.0) and 55 (3.2%) miRNAs were up-regulated (log ratio of more than 1.0) in pterygial fibroblasts. Further, 1280 (73.9%) miRNAs showed a minimal change in expression compared with those in control fibroblasts. Of the 145 miRNAs that were differentially expressed in pterygial fibroblasts according to the log ratio test, 18 up-regulated miRNAs and 9 down-regulated miRNAs met the second criterion, i.e. base log value of >7.0. None of the down-regulated miRNAs met the repetitive test criterion. Further, 4/18 up-regulated miRNAs, namely, miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p, showed consistent upregulation in repetitive tests. MiRNAs belonging to the miRNA-200 family and miRNA-145-3p showed low expression in both pterygial and control fibroblasts; moreover, miRNA-145-5p showed minimal changes in expression (Table 1).

Table 1 Expression of the major miRNAs

miRNAs	Log values of miRNAs		Log ratio of miRNAs
	Pterygial fibroblasts	Control fibroblasts
4 target miRNAs
miRNA-143a-3p	13.61	12.32	1.28
miRNA-181a-2-3p	10.09	8.33	1.77
miRNA-377-5p	7.53	6.42	1.10
miRNA-411a-5p	9.65	7.68	1.96
Other miRNAs
miRNA-145-3p	3.68	2.60	1.07
miRNA-145-5p	14.19	13.82	0.36
miRNA-200 family
miRNA-200a-3p	1.63	1.43	0.20
miRNA-200a-5p	1.54	1.93	-0.39
miRNA-200b-3p	5.43	5.68	-0.25
miRNA-200b-5p	2.26	2.13	0.12
miRNA-200c-3p	5.44	4.76	0.68
miRNA-200c-5p	1.85	1.86	-0.003

Four target miRNAs showed upregulation and previous reported miRNA-145-3p and miRNA-145-5p were slightly upregulated. miRNA-200 family had diverse response.

Figure 3 Screening of miRNAs Most miRNAs in pterygial fibroblasts were found from -1 to +1. X-axis indicates the log scale of miRNA expression in control and pterygial fibroblasts. Negative scale indicates downregulation, and positive scale indicates overexpression.

Secondary miRNA Analysis Primary screening of 1733 miRNAs identified 4 miRNAs (miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p) that met all the above-mentioned criteria and were up-regulated in pterygial fibroblasts compared with control fibroblasts (Figure 4). Of the 4 target miRNAs, miRNA-143a-3p had the highest mean ratio compared with miRNAs in control fibroblasts (3.17±0.80). The mean ratios of miRNA-181a-2-3p, miRNA-377-5p, and miRNA-411a-5p were 1.72±0.22, 2.33±0.71, and 2.18±0.66, respectively (Figure 5).

Figure 4 Heat map analysis Heat map of differentially expressed miRNA loci (left column: control fibroblasts; right column: pterygial fibroblasts).

Figure 5 Analysis of the 4 target miRNAs The 4 miRNAs were significantly up-regulated in pterygial fibroblasts.

DISCUSSION

Results of the present study showed that miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p were up-regulated in pterygial fibroblasts compared with control fibroblasts, suggesting their involvement in the pathogenesis of pterygium.

miRNA-143a-3p had the highest overexpression rate among all the miRNAs analyzed. Few studies have been performed on miRNA-143a-3p, and it is suggested to be involved in the pathogenesis of cardiac morphogenesis and cancer^[10-11]. miRNA-143 shows the lowest expression in various tumors and is thought to act as a tumor suppressor^[12]. However, miRNA-143a-3p was overexpressed in pterygial fibroblasts in the present study, suggesting its involvement in the pathogenesis of pterygium. miRNA-181a-2-3p was also markedly up-regulated in pterygial fibroblasts compared with control fibroblasts. miRNAs belonging to the microRNA-181 family, including miRNA-181, are significantly up-regulated in human hepatocellular carcinoma cells^[13]. miRNAs belonging to the miRNA-181 family play a critical role in PAH-induced hepatocarcinogenesis by targeting mitogen-activated protein kinase (MAPK) phosphatase-5, thus regulating p38 MAPK activation. Compared with healthy conjunctivas, pterygial tissues also contain activated MAPKs^[14]. Therefore, miRNA-181a-2-3p may play a key role in the pathogenesis of pterygium.

The results of the present study showed that miRNA-377-5p was up-regulated in pterygial fibroblasts compared with control fibroblasts. Wang et al^[15] reported that overexpression of miRNA-377 in diabetic nephropathy indirectly increased the production of fibronectin. Pterygial tissues show increased expression of fibronectin and macrophage inflammatory protein-4^[16]. Therefore, the results of the present study suggest that miRNA-377-5p may be involved in increasing the levels of fibronectin in pterygium.

The results of the present study also showed that miRNA-411a-5p expression was up-regulated in pterygial fibroblasts compared with control fibroblasts. miRNA-411 belongs to the miRNA-379 family and is expressed from the miRNA-379/miRNA-656 cluster located within the DLK-DIO3 region on human chromosome 14^[17]. Harafuji et al^[18] reported that overexpression of miRNA-411 decreased the mRNA expression of YY1-associated factor 2 (YAF2), which negatively regulates muscle-restricted genes, in myoblasts. To date, no study has investigated YAF2 expression in pterygial fibroblasts. However, microRNA-411a-5p may induce pterygium through other mechanisms.

Lan et al^[19] reported that decreased miRNA-215 expression may increase fibroblast cycling and proliferation and induce pterygium formation. miRNA-221 may influence pterygium formation through p27KIP1^[20]. In the present study, miRNA-215 and miRNA-211 were slightly down-regulated in pterygial fibroblasts (data not shown), suggesting that these 2 miRNAs were involved in the pathogenesis of pterygium.

Primary screening performed in the present study showed that miRNA-145-3p and miRNA-145-5p were up-regulated in pterygial fibroblasts. However, secondary analysis by performing PCR did not provide consistent results. This discrepancy might have resulted from the use of different methodologies in 2 studies. We analyzed pterygial fibroblasts in the present study and whole pterygial tissues in our previous study. In the present study, miRNAs belonging to the miRNA-200 family, including miRNA-200a-3p, miRNA-200a-5p, miRNA-200b-3p, miRNA-200b-5p, miRNA-200c-3p, and miRNA-200c-5p, did not show consistent expression, with miRNA-200a-3p, miRNA-200b-5p, and miRNA-200c-3p showing slight upregulation and miRNA-200a-5p, miRNA-200b-3p, and miRNA-200c-5p showing slight downregulation. However, overall expression of these miRNAs was low in both pterygial and control fibroblasts. The ratios suggesting differential regulation were not significant.

Thus, the results of the present study showed that 4 out of 1733 mature human miRNAs, namely, miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p, and miRNA-411a-5p were substantially up-regulated in pterygial fibroblasts compared with those in control fibroblasts. These results suggested that differential expression of these miRNAs is involved in the pathogenesis of pterygium. However, further studies should be performed to confirm these results.

ACKNOWLEDGEMENTS

Foundations: Supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology Grant 2010-0009023; Konyang University Myunggok Research Fund of 2013.

Conflicts of Interest: Lee JH, None; Jung SA, None; Kwon YA, None; Chung JL, None; Kim US, None.

REFERENCES

1 Fuller JR, Bevin TH, Molteno AC, Vote BJ, Herbison P. Anti-inflammatory fibrosis suppression in threatened trabeculectomy bleb failure produces good long term control of intraocular pressure without risk of sight threatening complications. Br J Ophthalmol 2002;86(12):1352-1354. [CrossRef] [PubMed]

2 Urban RC Jr, Kaufman LM. Mitomycin in the treatment of hypertrophic conjunctival scars after strabismus surgery. J Pediatr Ophthalmol Strabismus 1994;31(2):96-98. [PubMed]

3 Coroneo MT, Di Girolamo N, Wakefield D. The pathogenesis of pterygia. Curr Opin Ophthalmol 1999;10(4):282-288. [CrossRef]

4 Dushku N, John MK, Schultz GS, Reid TW. Pterygia pathogenesis: corneal invasion by matrix metalloproteinase expressing altered limbal epithelial basal cells. Arch Ophthalmol 2001;119(5):695-706. [CrossRef]

5 Jia Z, Wang K, Wang G, Zhang A, Pu P. MiR-30a-5p antisense oligonucleotide suppresses glioma cell growth by targeting SEPT7. PLoS One 2013;8(1):e55008. [CrossRef] [PubMed] [PMC free article]

6 Wilson RC, Doudna JA. Molecular mechanisms of RNA interference. Annu Rev Biophys 2013;42:217-239. [CrossRef] [PubMed]

7 Chien KH, Chen SJ, Liu JH, Chang HM, Woung LC, Liang CM, Chen JT, Lin TJ, Chiou SH, Peng CH. Correlation between microRNA-34a levels and lens opacity severity in age-related cataracts. Eye (Lond) 2013;27(7):883-888. [CrossRef] [PubMed] [PMC free article]

8 Chien KH, Chen SJ, Liu JH, Woung LC, Chen JT, Liang CM, Chiou SH, Tsai CY, Cheng CK, Hu CC,Peng CH. Correlation of microRNA-145 levels and clinical severity of pterygia. Ocul Surf 2013;11(2):133-138. [CrossRef] [PubMed]

9 Engelsvold DH, Utheim TP, Olstad OK, Gonzalez P, Eidet JR, Lyberg T, Trøseid AM, Dartt DA, Raeder S. miRNA and mRNA expression profiling identifies members of the miR-200 family as potential regulators of epithelial-mesenchymal transition in pterygium. Exp Eye Res 2013;115:189-198. [CrossRef] [PubMed] [PMC free article]

10 Yabushita S, Fukamachi K, Tanaka H, Sumida K, Deguchi Y, Sukata T, Kawamura S, Uwagawa S, Suzui M, Tsuda H. Circulating microRNAs in serum of human K-ras oncogene transgenic rats with pancreatic ductal adenocarcinomas. Pancreas 2012;41(7):1013-1018. [CrossRef] [PubMed]

11 Landgraf P, Rusu M, Sheridan R, et al. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 2007;129(7):1401-1414. [CrossRef] [PubMed] [PMC free article]

12 Ma Q, Jiang Q, Pu Q, Zhang X, Yang W, Wang Y, Ye S, Wu S, Zhong G, Ren J, Zhang Y, Liu L, Zhu W. MicroRNA-143 inhibits migration and invasion of human non-small-cell lung cancer and its relative mechanism. Int J Biol Sci 2013;9(7):680-692. [CrossRef] [PubMed] [PMC free article]

13 Song MK, Park YK, Ryu JC. Polycyclic aromatic hydrocarbon (PAH)-mediated upregulation of hepatic microRNA-181 family promotes cancer cell migration by targeting MAPK phosphatase-5, regulating the activation of p38 MAPK. Toxicol Appl Pharmacol 2013;273(1):130-139. [CrossRef] [PubMed]

14 Torres J, Enríquez-de-Salamanca A, Fernández I, Rodríguez-Ares MT, Quadrado MJ, Murta J, Benítez del Castillo JM, Stern ME, Calonge M. Activation of MAPK signaling pathway and NF-kappaB activation in pterygium and ipsilateral pterygium-free conjunctival specimens. Invest Ophthalmol Vis Sci 2011;52(8):5842-5852. [CrossRef] [PubMed]

15 Wang Q, Wang Y, Minto AW, Wang J, Shi Q, Li X, Quigg RJ. MicroRNA-377 is up-regulated and can lead to increased fibronectin production in diabetic nephropathy. FASEB J 2008;22(12):4126-4135. [CrossRef] [PubMed] [PMC free article]

16 John-Aryankalayil M, Dushku N, Jaworski CJ, Cox CA, Schultz G, Smith JA, Ramsey KE, Stephan DA, Freedman KA, Reid TW, Carper DA. Microarray and protein analysis of human pterygium. Mol Vis 2006;12:55-64. [PubMed]

17 Glazov EA, McWilliam S, Barris WC, Dalrymple BP. Origin, evolution, and biological role of miRNA cluster in DLK-DIO3 genomic region in placental mammals. Mol Biol Evol 2008;25(5):939-948. [CrossRef] [PubMed]

18 Harafuji N, Schneiderat P, Walter MC, Chen YW. miR-411 is up-regulated in FSHD myoblasts and suppresses myogenic factors. Orphanet J Rare Dis 2013;8:55. [CrossRef] [PubMed] [PMC free article]

19 Lan W, Chen S, Tong L. MicroRNA-215 Regulates fibroblast function: insights from a human fibrotic disease. Cell Cycle 2015;14(12):1973-1984. [CrossRef] [PubMed] [PMC free article]

20 Wu CW, Cheng YW, Hsu NY, Yeh KT, Tsai YY, Chiang CC, Wang WR, Tung JN. MiRNA-221 negatively regulated downstream p27Kip1 gene expression involvement in pterygium pathogenesis. Mol Vis 2014;20:1048-1056.
[PMC free article] [PubMed]

[Top]