·Basic Research·

Blockade of insulin receptor substrate-1 inhibits biological behavior of choroidal endothelial cells

Yi-Yong Qian^1,2, Hong-Ya Wu³, Gao-Qin Liu^1,3, Chi Ren¹, Pei-Rong Lu^1,3, Xue-Guang Zhang³

¹Department of Ophthalmology, the First Affiliated Hospital of Soochow University, Suzhou 215006, Jiangsu Province, China

²Department of Ophthalmology, Shanghai Tenth People’s Hospital, Tongji University School of Medicine, Shanghai 200072, China

³Jiangsu Key Laboratory of Clinical Immunology, the First Affiliated Hospital of Soochow University, Suzhou 215006, Jiangsu Province, China

Co-first author: Yi-Yong Qian and Hong-Ya Wu

Corresponding to: Pei-Rong Lu and Gao-Qin Liu. Department of Ophthalmology, the First Affiliated Hospital of Soochow University, 188 Shizi Street, Suzhou 215006, Jiangsu Province, China. lupeirong@suda.edu.cn; liugaoqin2006@sina.com

Received: 2018-07-27 Accepted: 2018-12-15

Abstract

AIM: To investigate the effects of blockade of insulin receptor substrate-1 (IRS-1) on the bio-function of tube formation of human choroidal endothelial cells (HCECs).

METHODS: Quantitative reverse transcription-polymerase chain reaction (RT-PCR) and Western blot were performed to determine the expression level of IRS-1 and phospho-IRS-1 in HCECs. Tube formation of HCECs was analyzed using three dimensional in vitro Matrigel assay with or without IRS-1 blockage via IRS-1 inhibitor (GS-101) and vascular endothelial growth factor receptor 2 (VEGFR2) inhibitor. In addition, cell counting kit (CCK)-8 and Transwell migration assay were exerted to analyze the effects of blockade of IRS-1 on the bio-function of proliferation and migration of HCECs, respectively. The apoptosis of HCECs was examined using flow cytometry (FCM).

RESULTS: RT-PCR and Western blot revealed that IRS-1 phospho-IRS-1 were expressed in HCECs and the expression level was enhanced by stimulation of VEGF-A. The number of tube formation was decreased significantly in GS-101 treated groups compared to phosphate buffered saline (PBS) treated control groups. Furthermore, both cell proliferation and migration of HCECs were decreased in the presence of GS-101. FCM analysis showed that the apoptosis of HCECs was enhanced when the cells were treated with GS-101. Western blot also showed that the expression level of cleaved-caspase 3 in GS-101 treated group was higher than that in control group.

CONCLUSION: Blockade of IRS-1 can inhibit tube formation of HCECs through reducing cell proliferation and migration and promoting cell apoptosis.

KEYWORDS: insulin receptor substrate-1; choroidal endothelial cells; neovascularization; proliferation

DOI:10.18240/ijo.2019.09.03

Citation: Qian YY, Wu HY, Liu GQ, Ren C, Lu PR, Zhang XG. Blockade of insulin receptor substrate-1 inhibits biological behavior of choroidal endothelial cells. Int J Ophthalmol 2019;12(9):1386-1394

INTRODUCTION

Choroidal neovascularization (CNV), known as a crucial late complication for pathological myopia and wet age-related macular degeneration (AMD), is characterized by new capillary vessels growing in choroid and breaking through Bruch’s membrane and further growing into the subretinal space, frequently causing severe visual impairment^[1-4]. It is well known that targeting on vascular endothelial growth factor (VEGF)-A is currently the most efficient treatment to exudative AMD in clinical settings, despite numerous regulatory factors involved in angiogenic, inflammatory and immune modulatory cascade have been confirmed in CNV occurrence and development^[5-8]. However, anti-VEGF agents can also induce local and systemic side effects^[9]. Therefore, in order to create novel therapeutic targets, it is necessary to obtain better knowledge of the mechanisms of CNV development^[10].

Insulin receptor substrate (IRS)-1, currently known as the first indentified member of IRS protein (or cytoplasmic adaptor proteins) family, is extensively expressed in various mammalian cells^[11]. It functions as crucial ligand in triggering insulin-induced response in human cells by binding to its cognate receptor^[11-12]. Like other members in IRS protein family, IRS-1 has no intrinsic enzymatic property but it can be activated after phosphorylation^[12]. It plays key role in lifespan determination and cellular stress resistance^[13-14], adipogenesis^[15], glucose homeostasis^[16-17] and cancer metabolism^[18] under physiological and pathological conditions. Accumulating evidence indicated that IRS-1 has an important role in occurrence and development of neovascularization in some ocular neovascularization diseases^[19-21]. It was reported that the occurrence of experimental CNV was restrained in IRS-1 knockout mice when compared to that in wild type mice^[21]. Furthermore, there was evidence also showing that application of the antisense oligonucleotide targeting on human IRS-1 mRNA, GS-101 (5’-TATCCGGAGGGCTCGCCATGCTGCT-3’), acting as IRS-1 inhibitor, can suppress corneal neovascularization significantly both in experimental corneal neovascularization animal models and patients with keratitis^[22-24]. These findings have proven and highlighted the anti-angiogenic efficacy of IRS-1 inhibitor in treating ocular neovascularization diseases.

Though IRS-1 has an important role in some ocular neovascularization diseases, the mechanism underlying IRS-1 promoting neovascularization or IRS-1 inhibitor suppressing neovascularization in this process has not yet been fully elucidated. Some reports revealed that the pro-angiogenic effects of IRS-1 may be related to interaction with VEGF-A^[21,25] and integrin signaling^[26-27], but it still need further exploration to verify and delineate the mechanism of this process. In present work, we detected the influences of blockade of IRS-1 on capabilities of tube formation, proliferation and migration of HCECs, and further examined the gene and protein expression of cytokines associated with tube formation of HCECs, then analyzed the exact mechanisms of blockade of IRS-1 affecting the bio-function of HCECs in this process. Our findings provide a novel insight into the mechanism of IRS-1 being involved in ocular neovascularization.

MATERIALS AND METHODS

Reagents And Antibodies The cell line of HCECs were obtained from Yaji Biological Technologies (Shanghai, China). IRS-1 inhibitor of GS101 was obtained from Invitrogen Life Technologies (Carlsbad, CA, USA). Annexin V-FITC Assay Kit (cat. No.556547) was obtained from BD Biosciences (Franklin Lakes, NJ, USA). The cell counting kit (CCK)-8 was obtained from Dojindo Molecular Technologies, Inc. (Kumamoto, Japan). Primers were synthesized by Shanghai Sangon Biological Engineering Technology and Service Co., Ltd. (Shanghai, China). Trypsin-EDTA was obtained from Sigma-Aldrich; Merck Millipore (Darmstadt, Germany). The total RNA extraction kit (RNeasy Mini kit) and reverse transcription kit (Ominiscript RT kit) were obtained from Qiagen Sciences, Inc. (Frederick, MA, USA). Matrigel was obtained from BD Biosciences (Franklin Lakes, NJ, USA). Dulbecco’s modified Eagle’s medium (DMEM) was obtained from HyClone; GE Healthcare Life Sciences (Logan, UT, USA). Fetal bovine serum (FBS) was obtained from PAA Laboratories; GE Healthcare Life Sciences. Transwell plates with 8.0 µm pore polycarbonate membrane insert were obtained from Corning Life Science (New York, USA). Mouse anti-human phospho-IRS-1 antibody (cat. No.3105-100) as well as rabbit anti human IRS-1 antibody (cat. No.3424-100) were purchased from BioVision (Milpitas, CA, USA). Rabbit anti- human phospho-vascular endothelial growth factor receptor 2 (VEGFR2) antibody (cat. No.44-1052), rabbit anti-human VEGFR2 antibody (cat. No.MA5-15157), rabbit anti-human cleaved-caspase 3 (cat. No.PA5-23921) and rabbit anti-human caspase 3 antibody (cat. No.700182) were obtained from Thermo Fisher Scientific (Waltham MA, USA). Mouse anti-human VEGFR2 antibody (cat. No.GTX53462) was obtained from GeneTex (Irvine, CA, USA). Mouse anti- human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody (cat. No.AF0006) was obtained from Beyotime Institute of Biotechnology (Shanghai, China).

Cell Culture Human choroidal endothelial cells (HCECs) were cultured in 5 mL DMEM medium (Gibco, Shelton, CT, USA) containing 10% FBS (Gibco) and incubated in 37℃ incubator with humidified atmosphere of 5 percent CO₂ and 95 percent air^[28]. Fresh culture medium was then added into the HCECs the next day. After incubation for 3-4d, confluent cells were passaged at a 1:4 dilution, and culture medium was renewed every other day. Functional assays in this study were performed using the cells in their logarithmic growth phase. In some experiments, cells were treated with VEGF-A and IRS-1 inhibitor (GS-101) at indicated concentrations or phosphate buffered saline (PBS) as control for 12 or 24h. The proliferation assay and migration assay were conducted in serum-free DMEM.

Semi-Quantitative Reverse Transcription-Polymerase Chain Reaction Analysis Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed as described in detail previously^[29]. Total RNA from the HCECs was isolated using an RNeasy Mini kit (Qiagen, Inc. Frederick, MA, USA) and cDNA was synthesized with the PrimeScript^TM RT Master mMix (TaKaRa Biotechnology Co., Ltd., Dalian, China). The mRNAs encoding IRS-1, VEGF-A, VEGFR2 as well as GAPDH were amplified using appropriate convenient primers. The sequences of the PCR primer pairs are listed in Table 1. Amplification of PCR was performed using a GeneAmp^® PCR System 9700 (Perkin-Elmer, Foster City, CA, USA). The PCR parameters involved in initial denaturation at 94℃ for 2min, followed by 37 or 25 (for GAPDH) cycles of denaturation at 95℃ for 30s, annealing at 58℃ for 35s and extension at 72℃ for 35s, and a final extension at 72℃ for 10min. Each sample was assayed in triplicate for both target and internal control (GAPDH) genes. These PCR products were fractionated on a 1.0% agarose gel and visualized using ethidium bromide. The intensities of the bands were determined and their ratios to GAPDH determined using Image J software, version 2.1.4.7 (National Institutes of Health, Bethesda, MD, USA).

Table 1 Sequences of the primers used for reverse transcription-polymerase chain reaction analysis

Gene	Sequence (5´-3´)	Annealing temperature (℃)	Cycles (n)
IRS-1	(F) GCAACCAGAGTGCCAAAGTG (R) CCTCTGGCTGCTTCTGGAAA	58	37
VEGF-A	(F) TGGTCCCAGGCTGCACCCAT (R) CGCATCGCATCAGGGGCACA	58	37
VEGFR2	(F) GGTACATGCCAACGACACAG (R) CTCAAAGTCTCTCACGAACACG	58	37
GAPDH	(F) ACCACAGTCCATGCCATCAC (R) TCCACCACCCTGTTGCTGTA	58	25

F: Forward primer; R: Reverse primer.

Tube Formation Assay The in vitro capillary-like tube formation assay for assessment of the effect of blockade of IRS-1 on the HCECs was examined using matrigel matrix as described in a previous report with some modifications^[30]. Briefly, a 96-well plate was incubated on ice and coated with 50 μL per well of fully thawed Matrigel^TM. The samples were centrifuged at 300×g for 10min at 4℃ to remove the air bubbles. The samples were subsequently incubated at 37°C for 30min in order to allow matrigel solidification. HCECs were cultured in different medium with or without GS-101 and/or VEGFR2 inhibitor. The cells were seeded on the solidified matrigel immediately at a density of 1.5×10⁴ cells per well. The plates were placed in a humidified atmosphere of 5% CO₂ and 95% air at 37℃ for 12h to allow formation of capillary-like structures. Angiogenesis is the formation of capillary tubes and was assessed following 12h of cultivation. The tube-like capillary structures were examined under an Olympus TMS inverted phase contrast microscope (Olympus Corporation, Tokyo, Japan). The micrographs were captured using an Olympus digital camera.

Western Blot Analysis As described in detail previously^[31], HCECs were harvested using 0.25% Trypsin-EDTA. The supernatant was discarded and lysed in 150 mL lysis buffer, to which a protease inhibitor cocktail was added (Boehringer Mannheim, Indianapolis, IN, USA). The samples were then boiled for 5min and separated using 12.5% SDS-polyacrylamide gel electrophoresis under denaturing conditions. It was then electroblotted onto a polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were finally incubated at room temperature (RT) for 1h with the following antibodies: Anti- phospho-IRS-1 (1:200), anti-IRS-1 (1:200), anti-phospho-VEGFR2 (1:1000), anti-VEGFR2 (1:1000), anti-cleaved- caspase 3 (1:1000), anti-caspase 3 (1:1000) and anti-GAPDH (1:5000) antibodies. The immunoblot assays were then washed with PBST and incubated at RT for 1h with a horseradish peroxidase-labeled secondary antibody (1:10 000; cat. No.5196-2504 or 5178-2504; R&D Systems; Hercules, CA, USA). Enhanced chemiluminescence was used to visualize the blots (ECL Plus; Amersham; GE Healthcare Life Sciences) according to the manufacturer’s protocol. The intensities of the protein bands were determined and their ratios to GAPDH determined using Image J software, version 2.1.4.7 (National Institutes of Health, Bethesda, MD, USA).

Proliferation Assay To evaluate the effect of GS-101 on the proliferation of HCECs, we carried out the cell CCK-8 assay as described in detail previously^[32]. HCECs were seeded in a 96-well plate (2×10³ cells per well). The cells were then treated with or without IRS-1 inhibitor of GS-101. Following incubation for 24h, the medium was replaced with fresh DMEM containing CCK-8 (10 μL per well). The cells were subsequently incubated for an additional 2h. The absorbance was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The inhibition rate (IR) of the proliferation of cells in the groups was compared with the control group.

Migration Assay To evaluate the effect of blockade of IRS-1 on the migration of HCECs cells, a modified Boyden chamber assay was performed as described previously^[33]. Briefly, 1×10⁴ cells in 100 μL DMEM medium were seeded in the upper chambers. After 24h incubation, the medium was replaced and fresh DMEM medium was added. Totally 500 μL of DMEM medium were added in lower chambers and treated with GS-101 for another 24h. The migrated HCECs were fixed prior to staining with 0.5% crystal violet solution. Non-invading cells were swapped with a cotton swab. The infiltrated cells were counted under a phase contrast microscopy. Each assessment of each experimental group was repeated several times.

Flow Cytometrical Analysis Apoptosis was assayed by using the dual staining with Annexin V: FITC (BD Biosciences, Franklin Lakes, NJ, USA) and propidium iodide (PI)^[34]. Briefly, cells were harvested at 24h post-addition GS-101. Annexin V: FITC and PI were added to the cellular suspension, according to the manufacturer’s instructions, and were analyzed using a FACS Calibur flow cytometer (Becton–Dickinson, San Jose, CA, USA). Early apoptotic cells were counted for relative apoptotic changes. All experiments were performed at least three times. Fluorescence intensities were determined with the help of FACS Calibur (Becton‑Dickinson, Franklin Lakes, NJ, USA).

Statistical Analysis All data were expressed as mean± standard error of the mean (SEM) and analysed statistically by Student’s t-test (two-tailed) between two groups or by one-way analysis of variance (ANOVA) with Tukey’s multiple comparison within multiple groups with statistic software SPSS 18.0 (USA). A value of P<0.05 was considered as statistically significant. Each experiment was independently repeated at least 3 times.

RESULTS

Gene and Protein Levels of IRS-1 in HCECs RT-PCR analysis and Western Blot assay revealed that the gene level of IRS-1 and protein level of IRS-1 as well as phospho-IRS-1 in HCECs was enhanced in VEGF-A-treated groups compared to PBS-treated control group (Figure 1). These results suggested that IRS-1 may have a role in bioactivities of HCECs and is a possible target molecule to inhibit the activities. The observation of the expression of IRS-1 along with phospho-IRS-1 in above HCECs suggested the possible involvement of IRS-1 in HCEC bio-function (Figure 1).

Figure 1 Expression (gene and protein) of IRS-1 in HCECs A: Semi-quantitative RT-PCR analysis was applied to evaluate the mRNA expression of IRS-1; B: Quantitative data of the ratio from three independent experiments; C: Representative Western blot results from three independent experiments; D, E: Ratios of IRS-1 and phospho-IRS-1 to GAPDH protein bands in the control and VEGF-A groups were determined. All values are presented as the mean±standard error of the mean (n=3). ^aP<0.05.

IRS-1 Signaling Blockade via GS-101 Reduced Tube Formation of HCECs To determine whether IRS-1 had a role in activity of tube formation of HCECs, the HCEC cells were seeded in plates of 96 wells which coated with Matrigel and were incubated for 12h, the HCECs then formed capillary-like tubes. The results revealed that the HCECs treated with GS-101 showed declined numbers of tube formation in comparison with the numbers in control group (Figure 2). The results of tube formation, which was quantified and statistically analyzed, indicated that GS-101 suppressed tube formation. In addition, HCECs treated with GS-101 and VEGFR2 inhibitor exhibited more decreased tube formation than the cells treated with 40 μmol/L GS-101 alone, suggesting that VEGFR2 signaling is indispensable for angiogenesis, and the treatment of GS-101 combined with VEGFR2 inhibitor enhanced the anti-angiogenesis effect of blockade of IRS-1 signaling.

Figure 2 Effect of blockade of IRS-1 on the tube formation of HCECs A: Tube formation assays showed that blockade of IRS-1 significantly suppressed the tube formation of HCECs (magnification, ×200). B: The numbers of capillary-like structures of tube formation were quantified from three independent in vitro experiments. All data are showed as the mean±standard error of the mean (n=3). ^aP<0.05; ^bP<0.01.

Blockade of IRS-1 Suppressed Proliferation of HCECs To evaluate the role of IRS-1 in the bio-activities of HCECs, the effect of blockade of IRS-1 on HCEC proliferation was assessed in vitro. The HCECs were incubated in the presence of GS-101 for 24h, and cell viability was subsequently examined using CCK-8 kit. The proliferation rates of HCECs which treated with GS-101 were lower than those in the PBS treated control group (Figure 3). The analysis data of quantified optical density (OD) and IR values verified that GS-101 was capable of suppressing cell proliferation. It proposed that the reduction in the proliferation degree of HCECs resulted from blockade of IRS-1 signaling via GS-101 attributed to the IRS-1 potential of promoting tube formation of HCEC in vitro.

Figure 3 Effect of blockade of IRS-1 on the proliferation of HCECs Cell counting kit-8 assays of examining HCEC proliferation showed that cell proliferation in the GS-101 groups was reduced pronouncedly, in comparison with that in the control group. The data are presented as mean±standard error mean. ^aP<0.05; ^bP<0.01.

Blockade of IRS-1 Impaired Migration of HCECs We also carried out a migration assay to verify the effects of blockade of IRS-1 on HCECs. When co-cultured with GS-101, the number of infiltrated HCECs which migrated through the upper chambers of plates decreased compared to control group. The numbers of positive-stained migrated cells in IRS-1 groups were 19±2 (10 μmol/L GS-101 group), 16±1 (20 μmol/L GS-101 group) and 15±2 (40 μmol/L GS-101 group) and 25±2 (per mm²) in control group (Figure 4). This suggests that Blockade of IRS-1 inhibits migration of HCECs.

Figure 4 Effect of blockade of IRS-1 on the migration of HCECs Quantitative data of the migrated cells from three independent experiments. All values are presented as the mean±standard error of the mean (n=3). ^aP<0.05 and ^bP<0.01 compared with the control.

Declined Expression Levels of VEGF-A and its Receptor VEGFR2 in GS-101-treated HCECs In this work, the expression (gene and/or protein) levels of angiogenic factors of VEGF-A along with its receptor of VEGFR2 in HCECs were detected. The expression (gene and/or protein) levels of VEGF-A, VEGFR2 and phospho-VEGFR2 were lower in the GS-101 treated cells, in comparison with those in the PBS treated control groups (Figure 5). These in vitro results indicated that blockade of IRS-1 may suppress HCEC migration, proliferation and tube formation via decreasing angiogenesis by down-regulating the gene and/or protein expression of VEGF-A and its receptor of VEGFR2 and/or phospho-VEGFR2.

Figure 5 Effect of blockade of IRS-1 on mRNA and protein expression of VEGF-A and VEGFR2 in HCECS A: Semi-quantitative RT-PCR analysis was used to evaluate the mRNA expression of VEGF-A and VEGFR2; B, C: Quantitative data of the ratio from three independent experiments; D: Representative Western blot results from three independent experiments; E, F: Ratios of VEGFR2 and phospho-VEGFR2 to GAPDH protein bands in the control and GS-101 groups were determined. All values are presented as the mean ± standard error of the mean (n=3). ^aP<0.05 compared with the control.

Blockade of IRS-1 Increased Apoptosis of HCECs As indicated by flow cytometry (FCM; Figure 6), the GS-101 treated group exhibited higher expression level of FITC-Annexin V in HCECs when compared to the control group, suggesting that blockade of IRS-1 increased apoptosis of HCECs. Additional, the expression level of apoptosis associated protein of cleaved-caspase-3 was also elevated in GS-101 treated group in comparison to control group (Figure 6C). It showed statistically significance between these two groups (Figure 6E). To the best of our knowledge, the level of cleaved-caspase-3 protein expression directly reflects cell apoptosis degree. Thus, our results suggest that GS-101 have negative effect on cell viability by promoting cell apoptosis.

Figure 6 The proportion of Annexin V -positive HCECs and cleaved-caspase 3 expression after treatment with GS-101 A: Representative results from three to four tests of Annexin V positive cells from either control, GS-101 treated HCECs; B: Quantitative data of the ratio from three independent experiments. C: Representative Western blot results from three independent experiments; D, E: Ratios of caspase 3 and cleaved-caspase 3 to GAPDH protein bands in the control and GS-101 groups were determined. All values are presented as the mean±standard error of the mean (n=3). ^aP<0.05 compared with the control.

DISCUSSION

The results in present study verified that IRS-1 has an important role in tube formation, proliferation, migration and apoptosis of HCECs, whereas this efficacy of IRS-1 on HCECs was inhibited by IRS-1 inhibitor of GS-101. The results also demonstrated that blockade of IRS-1 affect the bio-function of HCECs through down-regulating VEGF-A/VEGFR2 signaling. Our data implied that IRS-1 would probably be a novel target for treating ocular neovascularization, such as CNV, in clinical settings.

As a signal receptor locating in cytoplasm of various cells, IRS-1 can induce intracellular signaling cascade and subsequently triggering cell bio-activities through its involvement in various cellular signal transduction^[35]. Bugner et al^[36] reported that IRS-1 was closely involved in growth of Xenopus laevis eye. Some studies also supported that IRS-1 played key role in process of ocular angiogenesis^[37]. Berdugo et al^[22] found that the reduced expression of IRS-1 in subconjunctival tissue by injecting with IRS-1 antisense (IRS-1 antagonist) leads to restrained corneal angiogenesis. Cloutier et al^[19] revealed that IRS-1 inhibitor have anti-angiogenic potential in suppressing retinal neovascularization (RNV) and CNV when topical administrating with GS-101 in non-human primate and rodent models, suggesting the promoting effect of IRS-1 on RNV or CNV. Additionally, Hos et al^[38] demonstrated that the blocking effect of GS-101 on IRS-1 signaling in corneas can also inhibit corneal lymph-angiogenesis in animal experiments. These results together with our findings provided novel insight on IRS-1 pro-angiogenesis or pro-lymph-angiogenesis efficacy in ocular diseases and suggested the latent application for IRS-1 inhibitor to treat ocular neovascularization, such as corneal neovascularization and CNV clinically^[37,39].

Several evidences documented that IRS-1 signaling was capable of influence cell migration^[40-41] and proliferation when the cells were treated with IRS-1 recombinant protein or IRS-1 inhibitor^[42-44]. Besides, other reports revealed that IRS-1 was involved in process of cell apoptosis in breast cancer cells^[45] and retinal endothelial cells^[46]. In present study, we also carried out relevant in vitro experiments to explore the precise mechanism of IRS-1 regulating the tube formation behavior of HCECs. The results verified that blockade of IRS-1 can suppress proliferation and migration, and increase apoptosis of HCECs. These results are consistent with above findings from other reports, suggesting that the anti-angiogenesis effect of blockade of IRS-1 on HCECs tube formation may be through inhibiting cell migration and cell proliferation and promoting cell apoptosis by IRS-1 inhibitor of GS-101.

Since vascular endothelial cells are fundamental for angiogenic process, any components that affect the bio-function of choroidal capillary endothelial cells may alter the development degree of CNV^[47-50]. To the best of our knowledge, VEGF-A is the most important factor that promoting vascularization both under physiological and pathological condition. It exerts pro-angiogenesis effects partially via facilitating vascular endothelial cell proliferation and migration. For the reason that verifying whether IRS-1 exerts pro-angiogenesis effect through VEGF-A/VEGFR2 signaling pathway, we examined VEGF-A and VEGFR2 expression in HCECs after treating the cells with serial concentrations of IRS-1 inhibitor of GS-101. Our results demonstrated that the gene and protein of VEGF-A is expressed in HCECs and decreased by IRS-1 inhibitor treatment in a dose-dependent way. In addition, the protein level of VEGFR2/phospho-VEGFR2 in HCECs, a receptor for VEGF-A, was also declined when the IRS-1 signaling was blocked by the inhibitor of GS-101. It suggested that blockade of IRS-1 exerting anti-angiogenesis effect may be, at least partly, through VEGF-A/VEGFR2 signaling pathway in the way of down-regulating the levels of VEGF-A and VEGF-A-cognate receptor of VEGFR2/phospho-VEGFR2.

It is well known that migration and proliferation of vascular endothelial cells were initial and vital steps for angiogenesis^[51-53]. The angiogenic cascade involves in many complicated and integrated sequential steps, in which vascular endothelial cells proliferation and migration are initial steps in the process of angiogenesis, followed by vascular endothelial cells behaviors of establishing and developing a capillary-like structure^[54-55]. Accordingly, the results in this work showed that blockade of IRS-1 exerted negative role in the bio-functions of proliferation and migration of HCECs, and enhanced apoptosis of HCECs, suggesting blockade of IRS-1 signaling exerted anti-angiogenic effects on HCECs via in-activating the initial steps of angiogenic cascade.

To summarize, the results of present study confirmed a novel biological role for IRS-1 in HCECs. Blockade of IRS-1 suppressed capillary tube formation through inhibiting cell migration and proliferation of the initial step of angiogenic cascade. The effects may be, at least partly, through down-regulating the expression level of VEGF-A and VEGFR2/phospho-VEGFR2 (VEGF-A receptor), along with promoting cell apoptosis of HCECs. These findings indicate the potential of anti-angiogenesis by GS-101 in HCECs, which may assist to clinical treatment on ocular neovascularization in future.

ACKNOWLEDGEMENTS

The authors would like to thank Xue-Guang Zhang for excellent technical assistance in this study.

Foundations: Supported by the National Natural Science Foundation in China (No. 81671641; No.81970830; No.31600736); Suzhou Municipal Natural Science Foundation (No.SYS201745); Soochow University Doctoral Academic Talents Program (No.5832001313); Jiangsu Provincial Medical Youth Talent (No.QNRC2016718); Jiangsu Provincial Medical Innovation Team (No.CXTDA2017039); Jiangsu Provincial Natural Science Foundation (No.BK20151208); the Soochow Scholar Project of Soochow University (No.R5122001).

Conflicts of Interest: Qian YY, None; Wu HY, None; Liu GQ, None; Ren C, None; Lu PR, None; Zhang XG, None.

REFERENCES

1 Green WR. Histopathology of age-related macular degeneration. Mol Vis 1999;5:27.

2 Fine SL. Age-related macular degeneration 1969-2004: a 35-year personal perspective. Am J Ophthalmol 2005;139(3):405-420.
https://doi.org/10.1016/j.ajo.2004.11.050
PMid:15767048

3 Argon laser photocoagulation for neovascular maculopathy. Five-year results from randomized clinical trials. Macular Photocoagulation Study Group. Arch Ophthalmol 1991;109(8):1109-1114.
https://doi.org/10.1001/archopht.1991.01080080069030
PMid:1714270

4 Anderson DH, Mullins RF, Hageman GS, Johnson LV. A role for local inflammation in the formation of drusen in the aging eye. Am J Ophthalmol 2002;134(3):411-431.
https://doi.org/10.1016/S0002-9394(02)01624-0

5 Kvanta A, Algvere PV, Berglin L, Seregard S. Subfoveal fibrovascular membranes in age-related macular degeneration express vascular endothelial growth factor. Invest Ophthalmol Vis Sci 1996;37(9): 1929-1934.
https://doi.org/10.1016/S0002-9394(14)70522-7

6 Ishibashi T, Hata Y, Yoshikawa H, Nakagawa K, Sueishi K, Inomata H. Expression of vascular endothelial growth factor in experimental choroidal neovascularization. Graefes Arch Clin Exp Ophthalmol 1997; 235(3):159-167.
https://doi.org/10.1007/BF00941723
PMid:9085111

7 Kwak N, Okamoto N, Wood JM, Campochiaro PA. VEGF is major stimulator in model of choroidal neovascularization. Invest Ophthalmol Vis Sci 2000;41(10):3158-3164.

8 Heier JS, Brown DM, Chong V, et al. Intravitreal aflibercept (VEGF trap-eye) in wet age-related macular degeneration. Ophthalmology 2012;119(12):2537-2548.
https://doi.org/10.1016/j.ophtha.2012.09.006
PMid:23084240

9 Yu WZ, Bai YJ, Han N, Wang F, Zhao M, Huang L, Li XX. Inhibition of pathological retinal neovascularization by semaphorin 3A. Mol Vis 2013;19:1397-1405.

10 Ameri H, Liu H, Liu R, Ha Y, Paulucci-Holthauzen AA, Hu SQ, Motamedi M, Godley BF, Tilton RG, Zhang WB. TWEAK/Fn14 pathway is a novel mediator of retinal neovascularization. Invest Ophthalmol Vis Sci 2014;55(2):801-813.
https://doi.org/10.1167/iovs.13-12812
PMid:24408972 PMCid:PMC3920863

11 White MF, Maron R, Kahn CR. Insulin rapidly stimulates tyrosine phosphorylation of a Mr-185, 000 protein in intact cells. Nature 1985;318(6042):183-186.
https://doi.org/10.1038/318183a0
PMid:2414672

12 Sun XJ, Rothenberg P, Kahn CR, Backer JM, Araki E, Wilden PA, Cahill DA, Goldstein BJ, White MF. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 1991;352(6330):73-77.
https://doi.org/10.1038/352073a0
PMid:1648180

13 Selman C, Lingard S, Choudhury AI, et al. Evidence for lifespan extension and delayed age-related biomarkers in insulin receptor substrate 1 null mice. FASEB J 2008;22(3):807-818.
https://doi.org/10.1096/fj.07-9261com
PMid:17928362

14 Selman C, Partridge L, Withers DJ. Replication of extended lifespan phenotype in mice with deletion of insulin receptor substrate 1. PLoS One 2011;6(1):e16144.
https://doi.org/10.1371/journal.pone.0016144
PMid:21283571 PMCid:PMC3026792

15 Laustsen PG, Michael MD, Crute BE, Cohen SE, Ueki K, Kulkarni RN, Keller SR, Lienhard GE, Kahn CR. Lipoatrophic diabetes in Irs1(-/-)/Irs3(-/-) double knockout mice. Genes Dev 2002;16(24):3213-3222.
https://doi.org/10.1101/gad.1034802
PMid:12502742 PMCid:PMC187498

16 Dong XC, Park S, Lin XY, Copps K, Yi XJ, White MF. Irs1 and Irs2 signaling is essential for hepatic glucose homeostasis and systemic growth. J Clin Invest 2006;116(1):101-114.
https://doi.org/10.1172/JCI25735
PMid:16374520 PMCid:PMC1319221

17 Yang WM, Jeong HJ, Park SY, Lee W. Induction of miR-29a by saturated fatty acids impairs insulin signaling and glucose uptake through translational repression of IRS-1 in myocytes. FEBS Lett 2014;588(13): 2170-2176.
https://doi.org/10.1016/j.febslet.2014.05.011
PMid:24844433

18 Shaw LM. The insulin receptor substrate (IRS) proteins: at the intersection of metabolism and cancer. Cell Cycle 2011;10(11): 1750-1756.
https://doi.org/10.4161/cc.10.11.15824
PMid:21597332 PMCid:PMC3142458

19 Cloutier F, Lawrence M, Goody R, Lamoureux S, Al-Mahmood S, Colin S, Ferry A, Conduzorgues JP, Hadri A, Cursiefen C, Udaondo P, Viaud E, Thorin E, Chemtob S. Antiangiogenic activity of aganirsen in nonhuman primate and rodent models of retinal neovascular disease after topical administration. Invest Ophthalmol Vis Sci 2012;53(3):1195-1203.
https://doi.org/10.1167/iovs.11-9064
PMid:22323484

20 Fang SF, Ma X, Guo SP, Lu JM. MicroRNA-126 inhibits cell viability and invasion in a diabetic retinopathy model via targeting IRS-1. Oncol Lett 2017;14(4):4311-4318.
https://doi.org/10.3892/ol.2017.6695
PMid:28943945 PMCid:PMC5604121

21 Jiang ZY, He ZH, King BL, Kuroki T, Opland DM, Suzuma K, Suzuma I, Ueki K, Kulkarni RN, Kahn CR, King GL. Characterization of multiple signaling pathways of insulin in the regulation of vascular endothelial growth factor expression in vascular cells and angiogenesis. J Biol Chem 2003;278(34):31964-31971.
https://doi.org/10.1074/jbc.M303314200
PMid:12775712

22 Berdugo M, Andrieu-Soler C, Doat M, Courtois Y, BenEzra D, Behar-Cohen F. Downregulation of IRS-1 expression causes inhibition of corneal angiogenesis. Invest Ophthalmol Vis Sci 2005;46(11):4072-4078.
https://doi.org/10.1167/iovs.05-0105
PMid:16249482

23 Al-Mahmood S, Colin S, Farhat N, Thorin E, Steverlynck C, Chemtob S. Potent in vivo antiangiogenic effects of GS-101 (5'-TATCCGGAGGGCTCGCCATGCTGCT-3'), an antisense oligonucleotide preventing the expression of insulin receptor substrate-1. J Pharmacol Exp Ther 2009;329(2):496-504.
https://doi.org/10.1124/jpet.108.147496
PMid:19208899

24 Cursiefen C, Viaud E, Bock F, et al. Aganirsen antisense oligonucleotide eye drops inhibit keratitis-induced corneal neovascularization and reduce need for transplantation. Ophthalmology 2014;121(9):1683-1692.
https://doi.org/10.1016/j.ophtha.2014.03.038
PMid:24811963

25 Miele C, Rochford JJ, Filippa N, Giorgetti-Peraldi S, Van Obberghen E. Insulin and insulin-like growth factor-I induce vascular endothelial growth factor mRNA expression via different signaling pathways. J Biol Chem 2000;275(28):21695-21702.
https://doi.org/10.1074/jbc.M000805200
PMid:10777488

26 Vuori K, Ruoslahti E. Association of insulin receptor substrate-1 with integrins. Science 1994;266(5190):1576-1578.
https://doi.org/10.1126/science.7527156
PMid:7527156

27 Avraamides CJ, Garmy-Susini B, Varner JA. Integrins in angiogenesis and lymphangiogenesis. Nat Rev Cancer 2008;8(8):604-617.
https://doi.org/10.1038/nrc2353
PMid:18497750 PMCid:PMC2577722

28 Liu GQ, Wu HY, Chen L, Xu J, Wang MJ, Li D, Lu PR. Effects of interleukin-17 on human retinal vascular endothelial cell capillary tube formation in vitro. Mol Med Rep 2017;16(1):865-872.
https://doi.org/10.3892/mmr.2017.6623
PMid:28560397

29 Lu PR, Li LB, Liu GQ, van Rooijen N, Mukaida N, Zhang XG. Opposite roles of CCR2 and CX3CR1 macrophages in alkali-induced corneal neovascularization. Cornea 2009;28(5):562-569.
https://doi.org/10.1097/ICO.0b013e3181930bcd
PMid:19421039

30 Liu GQ, Zhang WP, Xiao YH, Lu PR. Critical role of IP-10 on reducing experimental corneal neovascularization. Curr Eye Res 2015;40(9):891-901.
https://doi.org/10.3109/02713683.2014.968934
PMid:25309995

31 Chen ZG, Liu GQ, Xiao YH, Lu PR. Adrenomedullin22-52 suppresses high-glucose-induced migration, proliferation, and tube formation of human retinal endothelial cells. Mol Vis 2014;20:259-269.

32 Chao TI, Xiang SH, Chen CS, Chin WC, Nelson AJ, Wang CC, Lu J. Carbon nanotubes promote neuron differentiation from human embryonic stem cells. Biochem Biophys Res Commun 2009;384(4):426-430.
https://doi.org/10.1016/j.bbrc.2009.04.157
PMid:19426708

33 Senger DR, Perruzzi CA, Streit M, Koteliansky VE, de Fougerolles AR, Detmar M. The alpha(1)beta(1) and alpha(2)beta(1) integrins provide critical support for vascular endothelial growth factor signaling, endothelial cell migration, and tumor angiogenesis. Am J Pathol 2002;160(1):195-204.
https://doi.org/10.1016/S0002-9440(10)64363-5

34 Liu GQ, Wu HY, Xu J, Wang MJ, Lu PR, Zhang XG. Anti-apoptosis effects of vascular endothelial cadherin in experimental corneal neovascularization. Int J Ophthalmol 2015;8(6):1083-1088.

35 White MF. The IRS-signaling system: a network of docking proteins that mediate insulin and cytokine action. Recent Prog Horm Res 1998;53:119-138.
https://doi.org/10.1007/978-3-642-80481-6_8
PMid:9401207

36 Bugner V, Aurhammer T, Kühl M. Xenopus laevis insulin receptor substrate IRS-1 is important for eye development. Dev Dyn 2011;240(7): 1705-1715.
https://doi.org/10.1002/dvdy.22659
PMid:21574211

37 Kain H, Goldblum D, Geudelin B, Thorin E, Beglinger C. Tolerability and safety of GS-101 eye drops, an antisense oligonucleotide to insulin receptor substrate-1: a 'first in man' phase I investigation. Br J Clin Pharmacol 2009;68(2):169-173.
https://doi.org/10.1111/j.1365-2125.2009.03450.x
PMid:19694734 PMCid:PMC2767278

38 Hos D, Regenfuss B, Bock F, Onderka J, Cursiefen C. Blockade of insulin receptor substrate-1 inhibits corneal lymphangiogenesis. Invest Ophthalmol Vis Sci 2011;52(8):5778-5785.
https://doi.org/10.1167/iovs.10-6816
PMid:21666240

39 Cursiefen C, Bock F, Horn FK, Kruse FE, Seitz B, Borderie V, Früh B, Thiel MA, Wilhelm F, Geudelin B, Descohand I, Steuhl KP, Hahn A, Meller D. GS-101 antisense oligonucleotide eye drops inhibit corneal neovascularization: interim results of a randomized phase II trial. Ophthalmology 2009;116(9):1630-1637.
https://doi.org/10.1016/j.ophtha.2009.04.016
PMid:19643487

40 Longato L, de la Monte S, Kuzushita N, Horimoto M, Rogers AB, Slagle BL, Wands JR. Overexpression of insulin receptor substrate-1 and hepatitis Bx genes causes premalignant alterations in the liver. Hepatology 2009;49(6):1935-1943.
https://doi.org/10.1002/hep.22856
PMid:19475691 PMCid:PMC2754284

41 Cao MR, Li YL, Lu HL, Meng QW, Wang L, Cai L, Dong XQ. MiR-23a-mediated migration/invasion is rescued by its target, IRS-1, in non-small cell lung cancer cells. J Cancer Res Clin Oncol 2014;140(10):1661-1670.
https://doi.org/10.1007/s00432-014-1725-0
PMid:24898878

42 Costa MM, Violato NM, Taboga SR, Góes RM, Bosqueiro JR. Reduction of insulin signalling pathway IRS-1/IRS-2/AKT/mTOR and decrease of epithelial cell proliferation in the prostate of glucocorticoid-treated rats. Int J Exp Pathol 2012;93(3):188-195.
https://doi.org/10.1111/j.1365-2613.2012.00817.x
PMid:22583132 PMCid:PMC3385916

43 Zhou Y, Feng X, Liu YL, Ye SC, Wang H, Tan WK, Tian T, Qiu YM, Luo HS. Down-regulation of miR-126 is associated with colorectal cancer cells proliferation, migration and invasion by targeting IRS-1 via the AKT and ERK1/2 signaling pathways. PLoS One 2013;8(11):e81203.
https://doi.org/10.1371/journal.pone.0081203
PMid:24312276 PMCid:PMC3843680

44 Wu YJ, Yu R, Cheng XH, Wu H, Wu CR, Wei GD, Zhang Q. Effect of Jiangang Yishen Recipe on high insulin induced cell proliferation of human glomerular mesangial cells and the expression of insulin receptor substrate 1 and phosphatidylinositol-3-kinase. Chin J Integr Tradit West Med 2014;34(5):597-601.

45 Tiwary R, Yu W, Sanders BG, Kline K. Α-TEA cooperates with MEK or mTOR inhibitors to induce apoptosis via targeting IRS/PI3K pathways. Br J Cancer 2011;104(1):101-109.
https://doi.org/10.1038/sj.bjc.6606019
PMid:21119656 PMCid:PMC3039802

46 Jiang YD, Zhang QH, Soderland C, Steinle JJ. TNFα and SOCS3 regulate IRS-1 to increase retinal endothelial cell apoptosis. Cell Signal 2012;24(5):1086-1092.
https://doi.org/10.1016/j.cellsig.2012.01.003
PMid:22266116 PMCid:PMC4073498

47 Becher MU, Nickenig G, Werner N. Regeneration of the vascular compartment. Herz 2010;35(5):342-351.
https://doi.org/10.1007/s00059-010-3360-0
PMid:20842474

48 Izumi N, Helker C, Ehling M, Behrens A, Herzog W, Adams RH. Fbxw7 controls angiogenesis by regulating endothelial Notch activity. PLoS One 2012;7(7):e41116.
https://doi.org/10.1371/journal.pone.0041116
PMid:22848434 PMCid:PMC3407154

49 Sacilotto N, Chouliaras KM, Nikitenko LL, Lu YW, Fritzsche M, Wallace MD, Nornes S, García-Moreno F, Payne S, Bridges E, Liu K, Biggs D, Ratnayaka I, Herbert SP, Molnár Z, Harris AL, Davies B, Bond GL, Bou-Gharios G, Schwarz JJ, De Val S. MEF2 transcription factors are key regulators of sprouting angiogenesis. Genes Dev 2016;30(20): 2297-2309.
https://doi.org/10.1101/gad.290619.116
PMid:27898394 PMCid:PMC5110996

50 Salminen A, Kauppinen A, Hyttinen JM, Toropainen E, Kaarniranta K. Endoplasmic reticulum stress in age-related macular degeneration: trigger for neovascularization. Mol Med 2010;16(11-12):535-542.
https://doi.org/10.2119/molmed.2010.00070
PMid:20683548 PMCid:PMC2972399

51 Carmeliet P, Jain RK. Molecular mechanisms and clinical applications of angiogenesis. Nature 2011;473(7347):298-307.
https://doi.org/10.1038/nature10144
PMid:21593862 PMCid:PMC4049445

52 Marcelo KL, Goldie LC, Hirschi KK. Regulation of endothelial cell differentiation and specification. Circ Res 2013;112(9):1272-1287.
https://doi.org/10.1161/CIRCRESAHA.113.300506
PMid:23620236 PMCid:PMC3768127

53 Adams RH, Alitalo K. Molecular regulation of angiogenesis and lymphangiogenesis. Nat Rev Mol Cell Biol 2007;8(6):464-478.
https://doi.org/10.1038/nrm2183
PMid:17522591

54 Griffioen AW, Molema G. Angiogenesis: potentials for pharmacologic intervention in the treatment of cancer, cardiovascular diseases, and chronic inflammation. Pharmacol Rev 2000;52(2):237-268.

55 Liekens S, De Clercq E, Neyts J. Angiogenesis: regulators and clinical applications. Biochem Pharmacol 2001;61(3):253-270.
https://doi.org/10.1016/S0006-2952(00)00529-3